ID: 923524370

View in Genome Browser
Species Human (GRCh38)
Location 1:234760660-234760682
Sequence AGGCCAGGGCACCACAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923524362_923524370 29 Left 923524362 1:234760608-234760630 CCATGCTTTACTAGGTCATGGAG No data
Right 923524370 1:234760660-234760682 AGGCCAGGGCACCACAGTGCAGG No data
923524367_923524370 -6 Left 923524367 1:234760643-234760665 CCTTTGAGCACACGCTCAGGCCA No data
Right 923524370 1:234760660-234760682 AGGCCAGGGCACCACAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923524370 Original CRISPR AGGCCAGGGCACCACAGTGC AGG Intergenic
No off target data available for this crispr