ID: 923525176

View in Genome Browser
Species Human (GRCh38)
Location 1:234767093-234767115
Sequence AGCTCCGAGATGGAAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923525168_923525176 22 Left 923525168 1:234767048-234767070 CCTGATTATTTACTGGCTGGTTG No data
Right 923525176 1:234767093-234767115 AGCTCCGAGATGGAAGGGAGAGG No data
923525170_923525176 -10 Left 923525170 1:234767080-234767102 CCCCTAGAGTATAAGCTCCGAGA No data
Right 923525176 1:234767093-234767115 AGCTCCGAGATGGAAGGGAGAGG No data
923525169_923525176 -9 Left 923525169 1:234767079-234767101 CCCCCTAGAGTATAAGCTCCGAG No data
Right 923525176 1:234767093-234767115 AGCTCCGAGATGGAAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923525176 Original CRISPR AGCTCCGAGATGGAAGGGAG AGG Intergenic
No off target data available for this crispr