ID: 923526387

View in Genome Browser
Species Human (GRCh38)
Location 1:234776015-234776037
Sequence CTGATAAGAATCAGATTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923526387_923526391 3 Left 923526387 1:234776015-234776037 CCTAGAAATCTGATTCTTATCAG No data
Right 923526391 1:234776041-234776063 TCTGAGCAACACAAGGGAGGAGG No data
923526387_923526392 6 Left 923526387 1:234776015-234776037 CCTAGAAATCTGATTCTTATCAG No data
Right 923526392 1:234776044-234776066 GAGCAACACAAGGGAGGAGGAGG No data
923526387_923526388 -4 Left 923526387 1:234776015-234776037 CCTAGAAATCTGATTCTTATCAG No data
Right 923526388 1:234776034-234776056 TCAGAACTCTGAGCAACACAAGG No data
923526387_923526390 0 Left 923526387 1:234776015-234776037 CCTAGAAATCTGATTCTTATCAG No data
Right 923526390 1:234776038-234776060 AACTCTGAGCAACACAAGGGAGG No data
923526387_923526393 22 Left 923526387 1:234776015-234776037 CCTAGAAATCTGATTCTTATCAG No data
Right 923526393 1:234776060-234776082 GAGGAGGCCTCCTGATGTCATGG No data
923526387_923526389 -3 Left 923526387 1:234776015-234776037 CCTAGAAATCTGATTCTTATCAG No data
Right 923526389 1:234776035-234776057 CAGAACTCTGAGCAACACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923526387 Original CRISPR CTGATAAGAATCAGATTTCT AGG (reversed) Intergenic
No off target data available for this crispr