ID: 923526538

View in Genome Browser
Species Human (GRCh38)
Location 1:234777116-234777138
Sequence AGGGAGAGGCCAGTGAAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923526531_923526538 10 Left 923526531 1:234777083-234777105 CCAGCACACATGGTGGTTAATGG No data
Right 923526538 1:234777116-234777138 AGGGAGAGGCCAGTGAAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923526538 Original CRISPR AGGGAGAGGCCAGTGAAGGT CGG Intergenic
No off target data available for this crispr