ID: 923529194

View in Genome Browser
Species Human (GRCh38)
Location 1:234800175-234800197
Sequence GGGTGTTGAATTTGCCAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923529192_923529194 -5 Left 923529192 1:234800157-234800179 CCAAAATGATAATGCTCCGGGTG No data
Right 923529194 1:234800175-234800197 GGGTGTTGAATTTGCCAGCACGG No data
923529188_923529194 29 Left 923529188 1:234800123-234800145 CCGAAGAGTCAGCAAGCTGTGCT No data
Right 923529194 1:234800175-234800197 GGGTGTTGAATTTGCCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923529194 Original CRISPR GGGTGTTGAATTTGCCAGCA CGG Intergenic
No off target data available for this crispr