ID: 923529689 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:234803491-234803513 |
| Sequence | CTGGAGTTGAGGGGGTGATG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 923529689_923529698 | 15 | Left | 923529689 | 1:234803491-234803513 | CCACATCACCCCCTCAACTCCAG | No data | ||
| Right | 923529698 | 1:234803529-234803551 | CAGCCACTTGTCTTCTCCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 923529689 | Original CRISPR | CTGGAGTTGAGGGGGTGATG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||