ID: 923529689

View in Genome Browser
Species Human (GRCh38)
Location 1:234803491-234803513
Sequence CTGGAGTTGAGGGGGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923529689_923529698 15 Left 923529689 1:234803491-234803513 CCACATCACCCCCTCAACTCCAG No data
Right 923529698 1:234803529-234803551 CAGCCACTTGTCTTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923529689 Original CRISPR CTGGAGTTGAGGGGGTGATG TGG (reversed) Intergenic
No off target data available for this crispr