ID: 923532369

View in Genome Browser
Species Human (GRCh38)
Location 1:234821635-234821657
Sequence ATGGCACAGAAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923532364_923532369 2 Left 923532364 1:234821610-234821632 CCCTGAGCCATCTGGACTAAAGC No data
Right 923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG No data
923532365_923532369 1 Left 923532365 1:234821611-234821633 CCTGAGCCATCTGGACTAAAGCA No data
Right 923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG No data
923532363_923532369 6 Left 923532363 1:234821606-234821628 CCTTCCCTGAGCCATCTGGACTA No data
Right 923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG No data
923532367_923532369 -5 Left 923532367 1:234821617-234821639 CCATCTGGACTAAAGCATATGGC No data
Right 923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923532369 Original CRISPR ATGGCACAGAAGAATGAGGA TGG Intergenic
No off target data available for this crispr