ID: 923536852

View in Genome Browser
Species Human (GRCh38)
Location 1:234859101-234859123
Sequence TAGGAAAACCATAATTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923536852_923536861 27 Left 923536852 1:234859101-234859123 CCACCCCAATTATGGTTTTCCTA No data
Right 923536861 1:234859151-234859173 ATTTCTAAAATACTCATTTTGGG No data
923536852_923536857 -10 Left 923536852 1:234859101-234859123 CCACCCCAATTATGGTTTTCCTA No data
Right 923536857 1:234859114-234859136 GGTTTTCCTAAAATCTATTTGGG No data
923536852_923536860 26 Left 923536852 1:234859101-234859123 CCACCCCAATTATGGTTTTCCTA No data
Right 923536860 1:234859150-234859172 AATTTCTAAAATACTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923536852 Original CRISPR TAGGAAAACCATAATTGGGG TGG (reversed) Intergenic
No off target data available for this crispr