ID: 923536852 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:234859101-234859123 |
Sequence | TAGGAAAACCATAATTGGGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
923536852_923536861 | 27 | Left | 923536852 | 1:234859101-234859123 | CCACCCCAATTATGGTTTTCCTA | No data | ||
Right | 923536861 | 1:234859151-234859173 | ATTTCTAAAATACTCATTTTGGG | No data | ||||
923536852_923536857 | -10 | Left | 923536852 | 1:234859101-234859123 | CCACCCCAATTATGGTTTTCCTA | No data | ||
Right | 923536857 | 1:234859114-234859136 | GGTTTTCCTAAAATCTATTTGGG | No data | ||||
923536852_923536860 | 26 | Left | 923536852 | 1:234859101-234859123 | CCACCCCAATTATGGTTTTCCTA | No data | ||
Right | 923536860 | 1:234859150-234859172 | AATTTCTAAAATACTCATTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
923536852 | Original CRISPR | TAGGAAAACCATAATTGGGG TGG (reversed) | Intergenic | ||
No off target data available for this crispr |