ID: 923537396

View in Genome Browser
Species Human (GRCh38)
Location 1:234863559-234863581
Sequence CAGTCCTGTGTTTCTGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923537396_923537405 25 Left 923537396 1:234863559-234863581 CCACATCCAGAAACACAGGACTG No data
Right 923537405 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
923537396_923537400 14 Left 923537396 1:234863559-234863581 CCACATCCAGAAACACAGGACTG No data
Right 923537400 1:234863596-234863618 ATTTTTTTCCCCCATAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923537396 Original CRISPR CAGTCCTGTGTTTCTGGATG TGG (reversed) Intergenic