ID: 923537398

View in Genome Browser
Species Human (GRCh38)
Location 1:234863565-234863587
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923537398_923537400 8 Left 923537398 1:234863565-234863587 CCAGAAACACAGGACTGGTTTCT No data
Right 923537400 1:234863596-234863618 ATTTTTTTCCCCCATAATTAAGG No data
923537398_923537405 19 Left 923537398 1:234863565-234863587 CCAGAAACACAGGACTGGTTTCT No data
Right 923537405 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923537398 Original CRISPR AGAAACCAGTCCTGTGTTTC TGG (reversed) Intergenic