ID: 923537399

View in Genome Browser
Species Human (GRCh38)
Location 1:234863594-234863616
Sequence TTAATTATGGGGGAAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923537399_923537407 9 Left 923537399 1:234863594-234863616 CCATTTTTTTCCCCCATAATTAA No data
Right 923537407 1:234863626-234863648 AAGGAAAGATGATTCGGATCTGG No data
923537399_923537405 -10 Left 923537399 1:234863594-234863616 CCATTTTTTTCCCCCATAATTAA No data
Right 923537405 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
923537399_923537406 3 Left 923537399 1:234863594-234863616 CCATTTTTTTCCCCCATAATTAA No data
Right 923537406 1:234863620-234863642 CTGCAGAAGGAAAGATGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923537399 Original CRISPR TTAATTATGGGGGAAAAAAA TGG (reversed) Intergenic
No off target data available for this crispr