ID: 923537401

View in Genome Browser
Species Human (GRCh38)
Location 1:234863604-234863626
Sequence TCTGCAGTCCTTAATTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923537401_923537408 26 Left 923537401 1:234863604-234863626 CCCCCATAATTAAGGACTGCAGA No data
Right 923537408 1:234863653-234863675 CAAGCTCAATGACTGAGAAAAGG No data
923537401_923537407 -1 Left 923537401 1:234863604-234863626 CCCCCATAATTAAGGACTGCAGA No data
Right 923537407 1:234863626-234863648 AAGGAAAGATGATTCGGATCTGG No data
923537401_923537406 -7 Left 923537401 1:234863604-234863626 CCCCCATAATTAAGGACTGCAGA No data
Right 923537406 1:234863620-234863642 CTGCAGAAGGAAAGATGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923537401 Original CRISPR TCTGCAGTCCTTAATTATGG GGG (reversed) Intergenic