ID: 923537403

View in Genome Browser
Species Human (GRCh38)
Location 1:234863606-234863628
Sequence CTTCTGCAGTCCTTAATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923537403_923537406 -9 Left 923537403 1:234863606-234863628 CCCATAATTAAGGACTGCAGAAG No data
Right 923537406 1:234863620-234863642 CTGCAGAAGGAAAGATGATTCGG No data
923537403_923537408 24 Left 923537403 1:234863606-234863628 CCCATAATTAAGGACTGCAGAAG No data
Right 923537408 1:234863653-234863675 CAAGCTCAATGACTGAGAAAAGG No data
923537403_923537407 -3 Left 923537403 1:234863606-234863628 CCCATAATTAAGGACTGCAGAAG No data
Right 923537407 1:234863626-234863648 AAGGAAAGATGATTCGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923537403 Original CRISPR CTTCTGCAGTCCTTAATTAT GGG (reversed) Intergenic
No off target data available for this crispr