ID: 923537404

View in Genome Browser
Species Human (GRCh38)
Location 1:234863607-234863629
Sequence CCTTCTGCAGTCCTTAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923537404_923537408 23 Left 923537404 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
Right 923537408 1:234863653-234863675 CAAGCTCAATGACTGAGAAAAGG No data
923537404_923537406 -10 Left 923537404 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
Right 923537406 1:234863620-234863642 CTGCAGAAGGAAAGATGATTCGG No data
923537404_923537407 -4 Left 923537404 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
Right 923537407 1:234863626-234863648 AAGGAAAGATGATTCGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923537404 Original CRISPR CCTTCTGCAGTCCTTAATTA TGG (reversed) Intergenic
No off target data available for this crispr