ID: 923537405

View in Genome Browser
Species Human (GRCh38)
Location 1:234863607-234863629
Sequence CCATAATTAAGGACTGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923537394_923537405 29 Left 923537394 1:234863555-234863577 CCTTCCACATCCAGAAACACAGG No data
Right 923537405 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
923537399_923537405 -10 Left 923537399 1:234863594-234863616 CCATTTTTTTCCCCCATAATTAA No data
Right 923537405 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
923537398_923537405 19 Left 923537398 1:234863565-234863587 CCAGAAACACAGGACTGGTTTCT No data
Right 923537405 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
923537396_923537405 25 Left 923537396 1:234863559-234863581 CCACATCCAGAAACACAGGACTG No data
Right 923537405 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923537405 Original CRISPR CCATAATTAAGGACTGCAGA AGG Intergenic