ID: 923537406

View in Genome Browser
Species Human (GRCh38)
Location 1:234863620-234863642
Sequence CTGCAGAAGGAAAGATGATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923537402_923537406 -8 Left 923537402 1:234863605-234863627 CCCCATAATTAAGGACTGCAGAA No data
Right 923537406 1:234863620-234863642 CTGCAGAAGGAAAGATGATTCGG No data
923537399_923537406 3 Left 923537399 1:234863594-234863616 CCATTTTTTTCCCCCATAATTAA No data
Right 923537406 1:234863620-234863642 CTGCAGAAGGAAAGATGATTCGG No data
923537403_923537406 -9 Left 923537403 1:234863606-234863628 CCCATAATTAAGGACTGCAGAAG No data
Right 923537406 1:234863620-234863642 CTGCAGAAGGAAAGATGATTCGG No data
923537401_923537406 -7 Left 923537401 1:234863604-234863626 CCCCCATAATTAAGGACTGCAGA No data
Right 923537406 1:234863620-234863642 CTGCAGAAGGAAAGATGATTCGG No data
923537404_923537406 -10 Left 923537404 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
Right 923537406 1:234863620-234863642 CTGCAGAAGGAAAGATGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923537406 Original CRISPR CTGCAGAAGGAAAGATGATT CGG Intergenic