ID: 923537408

View in Genome Browser
Species Human (GRCh38)
Location 1:234863653-234863675
Sequence CAAGCTCAATGACTGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923537404_923537408 23 Left 923537404 1:234863607-234863629 CCATAATTAAGGACTGCAGAAGG No data
Right 923537408 1:234863653-234863675 CAAGCTCAATGACTGAGAAAAGG No data
923537403_923537408 24 Left 923537403 1:234863606-234863628 CCCATAATTAAGGACTGCAGAAG No data
Right 923537408 1:234863653-234863675 CAAGCTCAATGACTGAGAAAAGG No data
923537402_923537408 25 Left 923537402 1:234863605-234863627 CCCCATAATTAAGGACTGCAGAA No data
Right 923537408 1:234863653-234863675 CAAGCTCAATGACTGAGAAAAGG No data
923537401_923537408 26 Left 923537401 1:234863604-234863626 CCCCCATAATTAAGGACTGCAGA No data
Right 923537408 1:234863653-234863675 CAAGCTCAATGACTGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923537408 Original CRISPR CAAGCTCAATGACTGAGAAA AGG Intergenic
No off target data available for this crispr