ID: 923539015

View in Genome Browser
Species Human (GRCh38)
Location 1:234875012-234875034
Sequence AATTATGCCCACTGTGGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923539015_923539023 18 Left 923539015 1:234875012-234875034 CCGTTTCCACAGTGGGCATAATT No data
Right 923539023 1:234875053-234875075 GGCCGCAAGCTGGACATACGTGG No data
923539015_923539025 21 Left 923539015 1:234875012-234875034 CCGTTTCCACAGTGGGCATAATT No data
Right 923539025 1:234875056-234875078 CGCAAGCTGGACATACGTGGTGG No data
923539015_923539019 -4 Left 923539015 1:234875012-234875034 CCGTTTCCACAGTGGGCATAATT No data
Right 923539019 1:234875031-234875053 AATTGAGGGCACCTAGAGTCAGG No data
923539015_923539020 -3 Left 923539015 1:234875012-234875034 CCGTTTCCACAGTGGGCATAATT No data
Right 923539020 1:234875032-234875054 ATTGAGGGCACCTAGAGTCAGGG No data
923539015_923539022 8 Left 923539015 1:234875012-234875034 CCGTTTCCACAGTGGGCATAATT No data
Right 923539022 1:234875043-234875065 CTAGAGTCAGGGCCGCAAGCTGG No data
923539015_923539026 25 Left 923539015 1:234875012-234875034 CCGTTTCCACAGTGGGCATAATT No data
Right 923539026 1:234875060-234875082 AGCTGGACATACGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923539015 Original CRISPR AATTATGCCCACTGTGGAAA CGG (reversed) Intergenic
No off target data available for this crispr