ID: 923539346

View in Genome Browser
Species Human (GRCh38)
Location 1:234877036-234877058
Sequence GCTACTTGGGAGGTTGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923539346_923539354 9 Left 923539346 1:234877036-234877058 CCTCTCTCAACCTCCCAAGTAGC No data
Right 923539354 1:234877068-234877090 AGGCGCCACCATGCCCCGTATGG No data
923539346_923539356 13 Left 923539346 1:234877036-234877058 CCTCTCTCAACCTCCCAAGTAGC No data
Right 923539356 1:234877072-234877094 GCCACCATGCCCCGTATGGTGGG No data
923539346_923539355 12 Left 923539346 1:234877036-234877058 CCTCTCTCAACCTCCCAAGTAGC No data
Right 923539355 1:234877071-234877093 CGCCACCATGCCCCGTATGGTGG No data
923539346_923539359 21 Left 923539346 1:234877036-234877058 CCTCTCTCAACCTCCCAAGTAGC No data
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923539346 Original CRISPR GCTACTTGGGAGGTTGAGAG AGG (reversed) Intergenic