ID: 923539350

View in Genome Browser
Species Human (GRCh38)
Location 1:234877046-234877068
Sequence TGTAACCCCAGCTACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923539350_923539359 11 Left 923539350 1:234877046-234877068 CCTCCCAAGTAGCTGGGGTTACA No data
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data
923539350_923539355 2 Left 923539350 1:234877046-234877068 CCTCCCAAGTAGCTGGGGTTACA No data
Right 923539355 1:234877071-234877093 CGCCACCATGCCCCGTATGGTGG No data
923539350_923539356 3 Left 923539350 1:234877046-234877068 CCTCCCAAGTAGCTGGGGTTACA No data
Right 923539356 1:234877072-234877094 GCCACCATGCCCCGTATGGTGGG No data
923539350_923539354 -1 Left 923539350 1:234877046-234877068 CCTCCCAAGTAGCTGGGGTTACA No data
Right 923539354 1:234877068-234877090 AGGCGCCACCATGCCCCGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923539350 Original CRISPR TGTAACCCCAGCTACTTGGG AGG (reversed) Intergenic