ID: 923539353

View in Genome Browser
Species Human (GRCh38)
Location 1:234877050-234877072
Sequence CGCCTGTAACCCCAGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923539353_923539354 -5 Left 923539353 1:234877050-234877072 CCAAGTAGCTGGGGTTACAGGCG No data
Right 923539354 1:234877068-234877090 AGGCGCCACCATGCCCCGTATGG No data
923539353_923539356 -1 Left 923539353 1:234877050-234877072 CCAAGTAGCTGGGGTTACAGGCG No data
Right 923539356 1:234877072-234877094 GCCACCATGCCCCGTATGGTGGG No data
923539353_923539355 -2 Left 923539353 1:234877050-234877072 CCAAGTAGCTGGGGTTACAGGCG No data
Right 923539355 1:234877071-234877093 CGCCACCATGCCCCGTATGGTGG No data
923539353_923539359 7 Left 923539353 1:234877050-234877072 CCAAGTAGCTGGGGTTACAGGCG No data
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923539353 Original CRISPR CGCCTGTAACCCCAGCTACT TGG (reversed) Intergenic