ID: 923539359

View in Genome Browser
Species Human (GRCh38)
Location 1:234877080-234877102
Sequence GCCCCGTATGGTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923539346_923539359 21 Left 923539346 1:234877036-234877058 CCTCTCTCAACCTCCCAAGTAGC 0: 1
1: 355
2: 9912
3: 110381
4: 210626
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data
923539350_923539359 11 Left 923539350 1:234877046-234877068 CCTCCCAAGTAGCTGGGGTTACA No data
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data
923539353_923539359 7 Left 923539353 1:234877050-234877072 CCAAGTAGCTGGGGTTACAGGCG No data
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data
923539352_923539359 8 Left 923539352 1:234877049-234877071 CCCAAGTAGCTGGGGTTACAGGC No data
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923539359 Original CRISPR GCCCCGTATGGTGGGATTAC AGG Intergenic