ID: 923539359

View in Genome Browser
Species Human (GRCh38)
Location 1:234877080-234877102
Sequence GCCCCGTATGGTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923539346_923539359 21 Left 923539346 1:234877036-234877058 CCTCTCTCAACCTCCCAAGTAGC No data
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data
923539353_923539359 7 Left 923539353 1:234877050-234877072 CCAAGTAGCTGGGGTTACAGGCG 0: 280
1: 22037
2: 147850
3: 176513
4: 255261
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data
923539350_923539359 11 Left 923539350 1:234877046-234877068 CCTCCCAAGTAGCTGGGGTTACA 0: 768
1: 51705
2: 146742
3: 249715
4: 528834
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data
923539352_923539359 8 Left 923539352 1:234877049-234877071 CCCAAGTAGCTGGGGTTACAGGC 0: 528
1: 38437
2: 163818
3: 263751
4: 444995
Right 923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923539359 Original CRISPR GCCCCGTATGGTGGGATTAC AGG Intergenic
No off target data available for this crispr