ID: 923540308 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:234884096-234884118 |
| Sequence | ATGTGACAGTGGCAGGTGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 923540304_923540308 | 11 | Left | 923540304 | 1:234884062-234884084 | CCAGAGGAGTAATATTTCAGCTG | No data | ||
| Right | 923540308 | 1:234884096-234884118 | ATGTGACAGTGGCAGGTGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 923540308 | Original CRISPR | ATGTGACAGTGGCAGGTGAA GGG | Intergenic | ||
| No off target data available for this crispr | |||||