ID: 923540308

View in Genome Browser
Species Human (GRCh38)
Location 1:234884096-234884118
Sequence ATGTGACAGTGGCAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923540304_923540308 11 Left 923540304 1:234884062-234884084 CCAGAGGAGTAATATTTCAGCTG No data
Right 923540308 1:234884096-234884118 ATGTGACAGTGGCAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923540308 Original CRISPR ATGTGACAGTGGCAGGTGAA GGG Intergenic
No off target data available for this crispr