ID: 923546729

View in Genome Browser
Species Human (GRCh38)
Location 1:234928769-234928791
Sequence TGTAAATCAGCTGCCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923546723_923546729 8 Left 923546723 1:234928738-234928760 CCTTCATGGGGATGCATCTCCTC No data
Right 923546729 1:234928769-234928791 TGTAAATCAGCTGCCGGGGCAGG No data
923546722_923546729 9 Left 923546722 1:234928737-234928759 CCCTTCATGGGGATGCATCTCCT No data
Right 923546729 1:234928769-234928791 TGTAAATCAGCTGCCGGGGCAGG No data
923546718_923546729 25 Left 923546718 1:234928721-234928743 CCATCTGATGGATTTTCCCTTCA No data
Right 923546729 1:234928769-234928791 TGTAAATCAGCTGCCGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923546729 Original CRISPR TGTAAATCAGCTGCCGGGGC AGG Intergenic
No off target data available for this crispr