ID: 923546747

View in Genome Browser
Species Human (GRCh38)
Location 1:234928896-234928918
Sequence GACGCTGCCCTGCTCTTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923546747_923546754 13 Left 923546747 1:234928896-234928918 CCTAATAAGAGCAGGGCAGCGTC No data
Right 923546754 1:234928932-234928954 TTTACAGAGACTGCTGAAGAAGG No data
923546747_923546756 15 Left 923546747 1:234928896-234928918 CCTAATAAGAGCAGGGCAGCGTC No data
Right 923546756 1:234928934-234928956 TACAGAGACTGCTGAAGAAGGGG No data
923546747_923546757 22 Left 923546747 1:234928896-234928918 CCTAATAAGAGCAGGGCAGCGTC No data
Right 923546757 1:234928941-234928963 ACTGCTGAAGAAGGGGCAGTTGG No data
923546747_923546758 23 Left 923546747 1:234928896-234928918 CCTAATAAGAGCAGGGCAGCGTC No data
Right 923546758 1:234928942-234928964 CTGCTGAAGAAGGGGCAGTTGGG No data
923546747_923546750 -10 Left 923546747 1:234928896-234928918 CCTAATAAGAGCAGGGCAGCGTC No data
Right 923546750 1:234928909-234928931 GGGCAGCGTCCCAGGGCCTAAGG No data
923546747_923546755 14 Left 923546747 1:234928896-234928918 CCTAATAAGAGCAGGGCAGCGTC No data
Right 923546755 1:234928933-234928955 TTACAGAGACTGCTGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923546747 Original CRISPR GACGCTGCCCTGCTCTTATT AGG (reversed) Intergenic
No off target data available for this crispr