ID: 923546752

View in Genome Browser
Species Human (GRCh38)
Location 1:234928919-234928941
Sequence TCTCTGTAAACCTTAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923546752_923546759 15 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546759 1:234928957-234928979 CAGTTGGGTCCTTCACTCTTTGG No data
923546752_923546756 -8 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546756 1:234928934-234928956 TACAGAGACTGCTGAAGAAGGGG No data
923546752_923546758 0 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546758 1:234928942-234928964 CTGCTGAAGAAGGGGCAGTTGGG No data
923546752_923546764 28 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546764 1:234928970-234928992 CACTCTTTGGTAGGGGAAGCAGG No data
923546752_923546761 20 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546761 1:234928962-234928984 GGGTCCTTCACTCTTTGGTAGGG No data
923546752_923546757 -1 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546757 1:234928941-234928963 ACTGCTGAAGAAGGGGCAGTTGG No data
923546752_923546755 -9 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546755 1:234928933-234928955 TTACAGAGACTGCTGAAGAAGGG No data
923546752_923546762 21 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546762 1:234928963-234928985 GGTCCTTCACTCTTTGGTAGGGG No data
923546752_923546754 -10 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546754 1:234928932-234928954 TTTACAGAGACTGCTGAAGAAGG No data
923546752_923546760 19 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546760 1:234928961-234928983 TGGGTCCTTCACTCTTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923546752 Original CRISPR TCTCTGTAAACCTTAGGCCC TGG (reversed) Intergenic