ID: 923546753

View in Genome Browser
Species Human (GRCh38)
Location 1:234928925-234928947
Sequence CAGCAGTCTCTGTAAACCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923546753_923546757 -7 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546757 1:234928941-234928963 ACTGCTGAAGAAGGGGCAGTTGG No data
923546753_923546764 22 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546764 1:234928970-234928992 CACTCTTTGGTAGGGGAAGCAGG No data
923546753_923546765 30 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546765 1:234928978-234929000 GGTAGGGGAAGCAGGATAAAAGG No data
923546753_923546762 15 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546762 1:234928963-234928985 GGTCCTTCACTCTTTGGTAGGGG No data
923546753_923546759 9 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546759 1:234928957-234928979 CAGTTGGGTCCTTCACTCTTTGG No data
923546753_923546760 13 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546760 1:234928961-234928983 TGGGTCCTTCACTCTTTGGTAGG No data
923546753_923546758 -6 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546758 1:234928942-234928964 CTGCTGAAGAAGGGGCAGTTGGG No data
923546753_923546761 14 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546761 1:234928962-234928984 GGGTCCTTCACTCTTTGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923546753 Original CRISPR CAGCAGTCTCTGTAAACCTT AGG (reversed) Intergenic
No off target data available for this crispr