ID: 923546755

View in Genome Browser
Species Human (GRCh38)
Location 1:234928933-234928955
Sequence TTACAGAGACTGCTGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923546751_923546755 -8 Left 923546751 1:234928918-234928940 CCCAGGGCCTAAGGTTTACAGAG No data
Right 923546755 1:234928933-234928955 TTACAGAGACTGCTGAAGAAGGG No data
923546752_923546755 -9 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546755 1:234928933-234928955 TTACAGAGACTGCTGAAGAAGGG No data
923546747_923546755 14 Left 923546747 1:234928896-234928918 CCTAATAAGAGCAGGGCAGCGTC No data
Right 923546755 1:234928933-234928955 TTACAGAGACTGCTGAAGAAGGG No data
923546746_923546755 19 Left 923546746 1:234928891-234928913 CCACTCCTAATAAGAGCAGGGCA No data
Right 923546755 1:234928933-234928955 TTACAGAGACTGCTGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923546755 Original CRISPR TTACAGAGACTGCTGAAGAA GGG Intergenic
No off target data available for this crispr