ID: 923546759

View in Genome Browser
Species Human (GRCh38)
Location 1:234928957-234928979
Sequence CAGTTGGGTCCTTCACTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923546753_923546759 9 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546759 1:234928957-234928979 CAGTTGGGTCCTTCACTCTTTGG No data
923546752_923546759 15 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546759 1:234928957-234928979 CAGTTGGGTCCTTCACTCTTTGG No data
923546751_923546759 16 Left 923546751 1:234928918-234928940 CCCAGGGCCTAAGGTTTACAGAG No data
Right 923546759 1:234928957-234928979 CAGTTGGGTCCTTCACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923546759 Original CRISPR CAGTTGGGTCCTTCACTCTT TGG Intergenic
No off target data available for this crispr