ID: 923546760

View in Genome Browser
Species Human (GRCh38)
Location 1:234928961-234928983
Sequence TGGGTCCTTCACTCTTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923546753_923546760 13 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546760 1:234928961-234928983 TGGGTCCTTCACTCTTTGGTAGG No data
923546751_923546760 20 Left 923546751 1:234928918-234928940 CCCAGGGCCTAAGGTTTACAGAG No data
Right 923546760 1:234928961-234928983 TGGGTCCTTCACTCTTTGGTAGG No data
923546752_923546760 19 Left 923546752 1:234928919-234928941 CCAGGGCCTAAGGTTTACAGAGA No data
Right 923546760 1:234928961-234928983 TGGGTCCTTCACTCTTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923546760 Original CRISPR TGGGTCCTTCACTCTTTGGT AGG Intergenic
No off target data available for this crispr