ID: 923546765

View in Genome Browser
Species Human (GRCh38)
Location 1:234928978-234929000
Sequence GGTAGGGGAAGCAGGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923546753_923546765 30 Left 923546753 1:234928925-234928947 CCTAAGGTTTACAGAGACTGCTG No data
Right 923546765 1:234928978-234929000 GGTAGGGGAAGCAGGATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923546765 Original CRISPR GGTAGGGGAAGCAGGATAAA AGG Intergenic
No off target data available for this crispr