ID: 923547261

View in Genome Browser
Species Human (GRCh38)
Location 1:234931938-234931960
Sequence AGGGCTGTTGTAGGAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923547261_923547269 17 Left 923547261 1:234931938-234931960 CCAGGAACTCCTACAACAGCCCT No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data
923547261_923547270 21 Left 923547261 1:234931938-234931960 CCAGGAACTCCTACAACAGCCCT No data
Right 923547270 1:234931982-234932004 GAAAATAGCAGAAACATGGCTGG No data
923547261_923547264 -4 Left 923547261 1:234931938-234931960 CCAGGAACTCCTACAACAGCCCT No data
Right 923547264 1:234931957-234931979 CCCTGCTCCCATCAGCGTTACGG No data
923547261_923547266 -1 Left 923547261 1:234931938-234931960 CCAGGAACTCCTACAACAGCCCT No data
Right 923547266 1:234931960-234931982 TGCTCCCATCAGCGTTACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923547261 Original CRISPR AGGGCTGTTGTAGGAGTTCC TGG (reversed) Intergenic