ID: 923547262

View in Genome Browser
Species Human (GRCh38)
Location 1:234931947-234931969
Sequence GATGGGAGCAGGGCTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923547262_923547266 -10 Left 923547262 1:234931947-234931969 CCTACAACAGCCCTGCTCCCATC No data
Right 923547266 1:234931960-234931982 TGCTCCCATCAGCGTTACGGTGG No data
923547262_923547269 8 Left 923547262 1:234931947-234931969 CCTACAACAGCCCTGCTCCCATC No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data
923547262_923547270 12 Left 923547262 1:234931947-234931969 CCTACAACAGCCCTGCTCCCATC No data
Right 923547270 1:234931982-234932004 GAAAATAGCAGAAACATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923547262 Original CRISPR GATGGGAGCAGGGCTGTTGT AGG (reversed) Intergenic