ID: 923547263

View in Genome Browser
Species Human (GRCh38)
Location 1:234931957-234931979
Sequence CCGTAACGCTGATGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923547263_923547270 2 Left 923547263 1:234931957-234931979 CCCTGCTCCCATCAGCGTTACGG No data
Right 923547270 1:234931982-234932004 GAAAATAGCAGAAACATGGCTGG No data
923547263_923547269 -2 Left 923547263 1:234931957-234931979 CCCTGCTCCCATCAGCGTTACGG No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923547263 Original CRISPR CCGTAACGCTGATGGGAGCA GGG (reversed) Intergenic