ID: 923547264

View in Genome Browser
Species Human (GRCh38)
Location 1:234931957-234931979
Sequence CCCTGCTCCCATCAGCGTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923547261_923547264 -4 Left 923547261 1:234931938-234931960 CCAGGAACTCCTACAACAGCCCT No data
Right 923547264 1:234931957-234931979 CCCTGCTCCCATCAGCGTTACGG No data
923547257_923547264 20 Left 923547257 1:234931914-234931936 CCTGAGACTCCTGCCTAGCTTTG No data
Right 923547264 1:234931957-234931979 CCCTGCTCCCATCAGCGTTACGG No data
923547259_923547264 11 Left 923547259 1:234931923-234931945 CCTGCCTAGCTTTGTCCAGGAAC No data
Right 923547264 1:234931957-234931979 CCCTGCTCCCATCAGCGTTACGG No data
923547256_923547264 29 Left 923547256 1:234931905-234931927 CCTAGAGATCCTGAGACTCCTGC No data
Right 923547264 1:234931957-234931979 CCCTGCTCCCATCAGCGTTACGG No data
923547260_923547264 7 Left 923547260 1:234931927-234931949 CCTAGCTTTGTCCAGGAACTCCT No data
Right 923547264 1:234931957-234931979 CCCTGCTCCCATCAGCGTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923547264 Original CRISPR CCCTGCTCCCATCAGCGTTA CGG Intergenic