ID: 923547266

View in Genome Browser
Species Human (GRCh38)
Location 1:234931960-234931982
Sequence TGCTCCCATCAGCGTTACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923547261_923547266 -1 Left 923547261 1:234931938-234931960 CCAGGAACTCCTACAACAGCCCT No data
Right 923547266 1:234931960-234931982 TGCTCCCATCAGCGTTACGGTGG No data
923547260_923547266 10 Left 923547260 1:234931927-234931949 CCTAGCTTTGTCCAGGAACTCCT No data
Right 923547266 1:234931960-234931982 TGCTCCCATCAGCGTTACGGTGG No data
923547262_923547266 -10 Left 923547262 1:234931947-234931969 CCTACAACAGCCCTGCTCCCATC No data
Right 923547266 1:234931960-234931982 TGCTCCCATCAGCGTTACGGTGG No data
923547259_923547266 14 Left 923547259 1:234931923-234931945 CCTGCCTAGCTTTGTCCAGGAAC No data
Right 923547266 1:234931960-234931982 TGCTCCCATCAGCGTTACGGTGG No data
923547257_923547266 23 Left 923547257 1:234931914-234931936 CCTGAGACTCCTGCCTAGCTTTG No data
Right 923547266 1:234931960-234931982 TGCTCCCATCAGCGTTACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923547266 Original CRISPR TGCTCCCATCAGCGTTACGG TGG Intergenic