ID: 923547267

View in Genome Browser
Species Human (GRCh38)
Location 1:234931964-234931986
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923547267_923547270 -5 Left 923547267 1:234931964-234931986 CCCATCAGCGTTACGGTGGAAAA No data
Right 923547270 1:234931982-234932004 GAAAATAGCAGAAACATGGCTGG No data
923547267_923547269 -9 Left 923547267 1:234931964-234931986 CCCATCAGCGTTACGGTGGAAAA No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923547267 Original CRISPR TTTTCCACCGTAACGCTGAT GGG (reversed) Intergenic