ID: 923547267 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:234931964-234931986 |
| Sequence | TTTTCCACCGTAACGCTGAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 923547267_923547269 | -9 | Left | 923547267 | 1:234931964-234931986 | CCCATCAGCGTTACGGTGGAAAA | No data | ||
| Right | 923547269 | 1:234931978-234932000 | GGTGGAAAATAGCAGAAACATGG | No data | ||||
| 923547267_923547270 | -5 | Left | 923547267 | 1:234931964-234931986 | CCCATCAGCGTTACGGTGGAAAA | No data | ||
| Right | 923547270 | 1:234931982-234932004 | GAAAATAGCAGAAACATGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 923547267 | Original CRISPR | TTTTCCACCGTAACGCTGAT GGG (reversed) | Intergenic | ||