ID: 923547268 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:234931965-234931987 |
Sequence | ATTTTCCACCGTAACGCTGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
923547268_923547270 | -6 | Left | 923547268 | 1:234931965-234931987 | CCATCAGCGTTACGGTGGAAAAT | No data | ||
Right | 923547270 | 1:234931982-234932004 | GAAAATAGCAGAAACATGGCTGG | No data | ||||
923547268_923547269 | -10 | Left | 923547268 | 1:234931965-234931987 | CCATCAGCGTTACGGTGGAAAAT | No data | ||
Right | 923547269 | 1:234931978-234932000 | GGTGGAAAATAGCAGAAACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
923547268 | Original CRISPR | ATTTTCCACCGTAACGCTGA TGG (reversed) | Intergenic | ||