ID: 923547269

View in Genome Browser
Species Human (GRCh38)
Location 1:234931978-234932000
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923547260_923547269 28 Left 923547260 1:234931927-234931949 CCTAGCTTTGTCCAGGAACTCCT No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data
923547267_923547269 -9 Left 923547267 1:234931964-234931986 CCCATCAGCGTTACGGTGGAAAA No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data
923547262_923547269 8 Left 923547262 1:234931947-234931969 CCTACAACAGCCCTGCTCCCATC No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data
923547263_923547269 -2 Left 923547263 1:234931957-234931979 CCCTGCTCCCATCAGCGTTACGG No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data
923547268_923547269 -10 Left 923547268 1:234931965-234931987 CCATCAGCGTTACGGTGGAAAAT No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data
923547261_923547269 17 Left 923547261 1:234931938-234931960 CCAGGAACTCCTACAACAGCCCT No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data
923547265_923547269 -3 Left 923547265 1:234931958-234931980 CCTGCTCCCATCAGCGTTACGGT No data
Right 923547269 1:234931978-234932000 GGTGGAAAATAGCAGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type