ID: 923548164

View in Genome Browser
Species Human (GRCh38)
Location 1:234939990-234940012
Sequence CTGCCGCCAGGGCTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923548164_923548176 30 Left 923548164 1:234939990-234940012 CCATCCACCAGCCCTGGCGGCAG No data
Right 923548176 1:234940043-234940065 CACAAGAGAAGAACTGCCCCTGG No data
923548164_923548171 6 Left 923548164 1:234939990-234940012 CCATCCACCAGCCCTGGCGGCAG No data
Right 923548171 1:234940019-234940041 CTCCTGCTCTGCCTCCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923548164 Original CRISPR CTGCCGCCAGGGCTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr