ID: 923548236

View in Genome Browser
Species Human (GRCh38)
Location 1:234940456-234940478
Sequence CTGAGAAAGCATGGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923548236_923548243 -4 Left 923548236 1:234940456-234940478 CCCTCCTCCCCATGCTTTCTCAG No data
Right 923548243 1:234940475-234940497 TCAGGATCCTTTGTCTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923548236 Original CRISPR CTGAGAAAGCATGGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr