ID: 923548673

View in Genome Browser
Species Human (GRCh38)
Location 1:234943787-234943809
Sequence TGGCATTCCCTTTGAATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923548673_923548683 30 Left 923548673 1:234943787-234943809 CCAGCTATTCAAAGGGAATGCCA No data
Right 923548683 1:234943840-234943862 TCCATTTATTTCTCCCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923548673 Original CRISPR TGGCATTCCCTTTGAATAGC TGG (reversed) Intergenic
No off target data available for this crispr