ID: 923550928

View in Genome Browser
Species Human (GRCh38)
Location 1:234962574-234962596
Sequence CAGTGCTTTCAGGAGAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923550925_923550928 5 Left 923550925 1:234962546-234962568 CCAAGATGTGTAGCAAACAAAAC No data
Right 923550928 1:234962574-234962596 CAGTGCTTTCAGGAGAAACTTGG No data
923550924_923550928 6 Left 923550924 1:234962545-234962567 CCCAAGATGTGTAGCAAACAAAA No data
Right 923550928 1:234962574-234962596 CAGTGCTTTCAGGAGAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923550928 Original CRISPR CAGTGCTTTCAGGAGAAACT TGG Intergenic
No off target data available for this crispr