ID: 923551019

View in Genome Browser
Species Human (GRCh38)
Location 1:234963372-234963394
Sequence GGCCTCCTGGGATTGCAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923551019_923551024 6 Left 923551019 1:234963372-234963394 CCGCGCTGCAATCCCAGGAGGCC No data
Right 923551024 1:234963401-234963423 CAGCGGCCATTATATCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923551019 Original CRISPR GGCCTCCTGGGATTGCAGCG CGG (reversed) Intergenic