ID: 923551071

View in Genome Browser
Species Human (GRCh38)
Location 1:234963825-234963847
Sequence CAGTATTCCTTCACAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923551069_923551071 15 Left 923551069 1:234963787-234963809 CCGGAGAAAATTCTACAGAAACA 0: 1
1: 1
2: 2
3: 51
4: 539
Right 923551071 1:234963825-234963847 CAGTATTCCTTCACAGAGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 152
923551068_923551071 20 Left 923551068 1:234963782-234963804 CCACACCGGAGAAAATTCTACAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 923551071 1:234963825-234963847 CAGTATTCCTTCACAGAGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923551071 Original CRISPR CAGTATTCCTTCACAGAGCC AGG Intergenic
900190857 1:1351630-1351652 CAGTTCTCCCTCTCAGAGCCCGG - Intergenic
902744587 1:18464993-18465015 CAGTAACCCTTCACCCAGCCTGG - Intergenic
904132105 1:28282700-28282722 CATTATTACTCCACAGTGCCAGG - Intergenic
905411714 1:37774795-37774817 TTGTATTCCTTCACAGAGACGGG - Intergenic
909475917 1:76080722-76080744 CAGTATGGCTTCACTGAGACTGG + Intronic
910311703 1:85831428-85831450 CAGTCATACTTCACAAAGCCAGG - Intronic
911187644 1:94919541-94919563 CTCTATCCATTCACAGAGCCTGG + Intronic
915796116 1:158735280-158735302 CATTGGTCCTGCACAGAGCCTGG - Intergenic
918342203 1:183577317-183577339 CAGCCTCCCTTCAGAGAGCCCGG + Intronic
919547111 1:198937663-198937685 AAGTCATCCTTCACAGAGACTGG + Intergenic
922580339 1:226692601-226692623 CTGTCTTCCTCCAGAGAGCCTGG + Intronic
923466897 1:234256569-234256591 CAGCATTCCTTCACTGACCACGG + Intronic
923551071 1:234963825-234963847 CAGTATTCCTTCACAGAGCCAGG + Intergenic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
1063687753 10:8254815-8254837 CAGAATTCCATGAAAGAGCCAGG + Intergenic
1063895666 10:10678987-10679009 CAATATTCCCTCACATGGCCAGG + Intergenic
1065088978 10:22210566-22210588 CAGTATGCCTTCACACAGAAGGG + Intergenic
1065116282 10:22486285-22486307 CACTTTTCCTTCTCAGTGCCGGG + Intergenic
1067212058 10:44267487-44267509 CAGTTTTCCTTCTCACAGTCCGG - Intergenic
1068453590 10:57226169-57226191 CTGTATGCCTTCAGAAAGCCAGG - Intergenic
1074095833 10:110311608-110311630 CAATATTCCTTCACTAAGGCTGG - Intergenic
1074177403 10:111022964-111022986 CTGTATTTCTTAACAAAGCCTGG + Intergenic
1076585772 10:131546476-131546498 ATGCATTCCTGCACAGAGCCAGG - Intergenic
1077661007 11:4068638-4068660 CAATTTTCTTTCAGAGAGCCTGG + Intronic
1078237663 11:9501189-9501211 CCTTATTACTGCACAGAGCCAGG + Exonic
1082127731 11:48453049-48453071 CAGTTTTCCTTCTAACAGCCAGG + Intergenic
1082249685 11:49964372-49964394 CAGTTTTCCTTCTAACAGCCAGG - Intergenic
1082561284 11:54623978-54624000 CAGTTTTCCTTCTAACAGCCAGG + Intergenic
1085055305 11:73399689-73399711 CACCATTCCTTCCCAGGGCCGGG - Intergenic
1085379763 11:76104565-76104587 CATTATTCCATCATAGAACCTGG + Intronic
1086447660 11:86885290-86885312 TATTATTCCATCACAGTGCCGGG - Intronic
1087147212 11:94824092-94824114 CAGTATTCCTGCACAGAGGATGG + Intronic
1087593021 11:100216234-100216256 GAGTATTCTTCCACACAGCCAGG + Intronic
1088692971 11:112343738-112343760 CAGAGTTCCTGCAGAGAGCCAGG + Intergenic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1092983535 12:13821639-13821661 CAAGATTACTACACAGAGCCAGG - Intronic
1094805824 12:34090229-34090251 CAGTCTTCCATCAAAGACCCAGG - Intergenic
1102435716 12:112921776-112921798 CACTATTACATCTCAGAGCCAGG - Intronic
1107706174 13:43108466-43108488 CAGTATTCCTTTACAAATCTTGG + Exonic
1108319360 13:49272865-49272887 AAGAATTCCTTGACACAGCCTGG - Intronic
1110031680 13:70623030-70623052 TTGTAATCCTTCACAGTGCCTGG - Intergenic
1112306678 13:98280529-98280551 CCGTATAGCTGCACAGAGCCTGG + Intronic
1112452298 13:99523693-99523715 CTGTATCCCATCACAGTGCCTGG - Intronic
1114675869 14:24440111-24440133 CAGTATTCCTTCCCAGAGCTAGG - Exonic
1116589724 14:46756801-46756823 CAGAATTCCTTCACTTATCCTGG - Intergenic
1117648770 14:57880377-57880399 CATTCTTCCTTTACACAGCCAGG - Intronic
1118056255 14:62082501-62082523 CAGTAATCCAGCAGAGAGCCAGG - Intronic
1118349888 14:64966078-64966100 CACTCTTCCTTCTCAGACCCTGG + Intronic
1118685347 14:68285225-68285247 CAGTAACCCTTAACAGAGCCAGG + Intronic
1119305727 14:73606744-73606766 CAGGACTCCTTCCCTGAGCCCGG + Intergenic
1121044447 14:90777715-90777737 GAATATTCCTACACAGAGCTAGG + Intronic
1121847611 14:97186902-97186924 GTGTATTACTCCACAGAGCCTGG - Intergenic
1122474192 14:101995142-101995164 GAGTATTTCATCACAGAGCTGGG - Intronic
1124193008 15:27597007-27597029 CAGCAATCCTGCACAAAGCCTGG + Intergenic
1127714350 15:61634247-61634269 CAATATTTCTTCACACAGCTAGG + Intergenic
1131676811 15:94678229-94678251 CAGTATACTTTCTCATAGCCAGG - Intergenic
1134301792 16:12998213-12998235 CAGGTTTACTTCATAGAGCCTGG + Intronic
1137339640 16:47588473-47588495 CAATATCCATTCACAGAGCTAGG - Intronic
1137479779 16:48842639-48842661 CAGTCTTCTTTCCCAGAGACAGG + Intergenic
1138394142 16:56691315-56691337 CAGTGGTCCTTCAGAGAGACAGG + Intronic
1140189026 16:72798609-72798631 GAGTCTTCTCTCACAGAGCCTGG + Exonic
1144405328 17:14947448-14947470 CAGTGTTGTTACACAGAGCCTGG + Intergenic
1147653975 17:42078048-42078070 CAGTTGTCCTTCACAGTGACCGG + Intergenic
1151893417 17:76964371-76964393 CTGTATTCCTACCCAGTGCCAGG - Intergenic
1154139639 18:11811430-11811452 CAGTATTCCTGGGCAGAGGCTGG - Intronic
1160019090 18:75166616-75166638 AAGCATTTCTTCACAGAACCCGG - Intergenic
1160576350 18:79856431-79856453 CCCTGTACCTTCACAGAGCCAGG + Intergenic
1164248738 19:23458318-23458340 CATTATTCCTTCTGGGAGCCTGG - Intergenic
927849150 2:26487988-26488010 CAGTTTATCTTCACAGAGGCTGG + Intronic
933796119 2:85921118-85921140 CAGTATACCTCCACCAAGCCCGG - Intergenic
934692409 2:96371900-96371922 CAGTCTCCCCTCACATAGCCAGG + Intronic
938734585 2:134174923-134174945 CAGTCCTCATTCTCAGAGCCTGG + Intronic
938993589 2:136654586-136654608 CAGAGGTCCTTCACACAGCCTGG - Intergenic
1169135783 20:3196208-3196230 CTGTGTTAATTCACAGAGCCAGG - Intronic
1170531646 20:17298830-17298852 AAATATTCCTTCTCAGAGGCTGG - Intronic
1171514682 20:25719939-25719961 CAGTTTTCCTTCTAAGAGTCAGG + Intergenic
1174391379 20:50220290-50220312 CAGTAAACATTTACAGAGCCAGG + Intergenic
1174537653 20:51264793-51264815 CAGGATTCCTTCTCAGAGGGTGG + Intergenic
1176247116 20:64102568-64102590 CAGGATTCCTCCAAAGAACCCGG - Intergenic
1177520608 21:22217833-22217855 CAGTACTCCTTGAAAGAGACTGG - Intergenic
1182138475 22:27930523-27930545 CACTAATCCTTCAGAAAGCCTGG - Intergenic
1184021221 22:41822750-41822772 CAGGATTCACTCACAGAGACAGG + Intronic
949765921 3:7525494-7525516 CAGGTATCCATCACAGAGCCTGG + Intronic
952421166 3:33132431-33132453 CAGTCCTTCTTCAGAGAGCCTGG - Intronic
952530853 3:34260336-34260358 CAGTACTCCATCTCAGAGCTAGG + Intergenic
956084889 3:65598147-65598169 GAGCATTACATCACAGAGCCCGG + Intronic
957694358 3:83615365-83615387 CAGTATTCCTTTGCATACCCTGG - Intergenic
959195544 3:103175935-103175957 CAGTATTTCTATACAGAACCTGG + Intergenic
960768752 3:121168090-121168112 CAGTTTTCCTTCTAAGAGTCAGG - Intronic
965370483 3:167856016-167856038 AAGTATTCCTTCATTTAGCCAGG + Intergenic
965940270 3:174170437-174170459 CAATAATCCATCACGGAGCCAGG - Intronic
966057279 3:175709821-175709843 CAGTGGCCCTTTACAGAGCCAGG - Intronic
967986777 3:195101044-195101066 CAGAAGCCCTTCACAGAGACTGG - Intronic
969607954 4:8211673-8211695 CACTATCCCTTCCCAGTGCCTGG - Intronic
973990455 4:56401222-56401244 CTATATGCCTTCAAAGAGCCAGG + Intronic
974125373 4:57689886-57689908 CAGTGTTGCTTCACAGAGGTAGG + Intergenic
977559881 4:98521306-98521328 CAGTGTTTCTTTACAGAGCAAGG + Intronic
983226214 4:165088548-165088570 CAGCACTCCTTCCCAGAGCCTGG - Exonic
983405446 4:167323732-167323754 CAGGATTCCTTCAAACAGTCAGG - Intergenic
983531358 4:168812960-168812982 CAGCATTCTTTCAAACAGCCTGG - Intronic
983999801 4:174226178-174226200 AAGTATTTCCTCCCAGAGCCAGG + Intergenic
984144965 4:176048985-176049007 CAGTGTTCCTTCAAGGAGACAGG - Intergenic
984671565 4:182495034-182495056 CAGGTTTCCTTCAATGAGCCAGG - Intronic
984904026 4:184610360-184610382 CAGTGTTCCTTCCCAGGGCAAGG + Intergenic
986131646 5:4937444-4937466 CAGAATGCCAACACAGAGCCAGG + Intergenic
986621722 5:9682671-9682693 CAGTATTCTTTCTCAGTGTCAGG - Intronic
991292553 5:65046659-65046681 CAGTATTCAGACACAGAACCAGG - Intergenic
993230634 5:85231011-85231033 CAGTAAGTCTTCACAAAGCCGGG - Intergenic
993334173 5:86636243-86636265 CAGTATTTCTGCACTGAGCTTGG + Intergenic
997201661 5:132013398-132013420 GAGCATTTCTTCACAGAGCAGGG + Intergenic
997720362 5:136073809-136073831 CAGTAATGCCTCACAGGGCCTGG - Intergenic
999663533 5:153890162-153890184 CAGTATTCTTACCCAGTGCCTGG - Intergenic
1000851490 5:166345768-166345790 CAGAATTTATTCACAGTGCCGGG + Intergenic
1000966518 5:167664156-167664178 CAGTTGTACTTTACAGAGCCTGG - Intronic
1001730801 5:173955051-173955073 CAGGATTCCTTGTCAGAGCTGGG + Intronic
1001988614 5:176096886-176096908 GACTTTACCTTCACAGAGCCTGG - Exonic
1002228254 5:177741248-177741270 GACTTTACCTTCACAGAGCCTGG + Exonic
1003157006 6:3605304-3605326 CACTATTCCTGCCCAGAGGCTGG + Intergenic
1004559721 6:16736940-16736962 CATTGCTCCTTCACAGAGACTGG + Intronic
1005598837 6:27406159-27406181 CAGCATTGCTCCAGAGAGCCAGG - Intergenic
1005914601 6:30341619-30341641 CAGCCTGCCTTTACAGAGCCTGG - Intronic
1007165328 6:39824921-39824943 CAGTCTTCCTCTCCAGAGCCAGG + Intronic
1008680181 6:53863687-53863709 GAGTATACCTTCAAAAAGCCTGG - Intronic
1009977365 6:70685826-70685848 CAGTCTTCCTTCACAAAGAATGG - Intronic
1010010897 6:71047087-71047109 AACAATTCATTCACAGAGCCTGG + Intergenic
1013198659 6:107868798-107868820 CAGTATCCAGTCACAGAGCCTGG + Exonic
1023110609 7:36807138-36807160 CAGTGTGCCTCCACAGAGCTGGG + Intergenic
1024634673 7:51277099-51277121 CAGTCATCCTTCCCAGAGCCAGG + Intronic
1024832427 7:53476845-53476867 CAGTGCTCCTTCAGAGAGCCAGG + Intergenic
1025888154 7:65618775-65618797 TAGTACTTATTCACAGAGCCAGG + Intergenic
1026940443 7:74284814-74284836 CAGCTTTCCTTCACACAGCAGGG + Intergenic
1027229070 7:76261695-76261717 CAGGGTTCCTTCCCACAGCCAGG + Intronic
1027977322 7:85175353-85175375 CAATAAACCTTCAGAGAGCCTGG - Intronic
1032354572 7:131198130-131198152 CAGTTTTCCTTTTCAGGGCCTGG - Intronic
1032590771 7:133190277-133190299 CAGTATTCCTTCAAGTAGCTAGG - Intergenic
1033352596 7:140573745-140573767 CAGTCTTCTTTCACAGAGAAGGG + Intronic
1035182474 7:157099366-157099388 CAGTATTCCTACAGAGAGGATGG + Intergenic
1036615444 8:10384042-10384064 CTGTATGGCTTCACAGAGCAAGG - Intronic
1037675324 8:21046027-21046049 CAGTAACCCTTCACACAGCAGGG - Intergenic
1038494367 8:27991066-27991088 CTGCATTCCTGCAGAGAGCCAGG - Intronic
1040841242 8:51787221-51787243 CATTATTCCTTCAGCAAGCCTGG + Intronic
1042227186 8:66523072-66523094 CAGCATGCTGTCACAGAGCCTGG - Intergenic
1042705037 8:71657519-71657541 CAGCATTCTTGCACAGAGTCTGG - Intergenic
1042958310 8:74275775-74275797 CAGTTTTTCTTCACAGAACAAGG + Intronic
1043401220 8:79886207-79886229 CAGTAATATTTCCCAGAGCCAGG + Intergenic
1044817037 8:96124086-96124108 AAGTAATCCCTGACAGAGCCGGG - Intergenic
1049483389 8:142838721-142838743 TTGGATTCCTTCACAGAGCATGG - Intronic
1053512290 9:38698552-38698574 CATTTTTCCTCCAGAGAGCCAGG + Intergenic
1057034966 9:91805317-91805339 CAGCATTCCTTCTCCCAGCCTGG + Intronic
1057253607 9:93524815-93524837 CAGGCTTCCTGCACAGTGCCCGG + Intronic
1060246450 9:121950568-121950590 CAGGGGTCCTTCAGAGAGCCTGG + Intronic
1060785901 9:126451477-126451499 CAGGGTTCCTGCTCAGAGCCTGG - Intronic
1061597455 9:131641148-131641170 AAGTGTTGCTTCCCAGAGCCAGG - Intronic
1062261217 9:135664075-135664097 CAGTCTTCCCTCCCAGGGCCCGG - Intronic
1188328323 X:28835376-28835398 TACTATTCCCTCACACAGCCTGG - Intronic
1191786089 X:64918501-64918523 CAGTGTAACATCACAGAGCCTGG - Intronic
1193197425 X:78649801-78649823 CAGTATTCTTTCTAAGAGCTAGG + Intergenic
1194216860 X:91140878-91140900 CACTATCCCTTCACAGACTCTGG + Intergenic
1195047303 X:101065735-101065757 CAGTATTTCTGCAAAGAGCTGGG + Intergenic
1200045460 X:153398510-153398532 CAGTTTTCCTGCACAGCCCCAGG - Intergenic
1201938771 Y:19435756-19435778 TAGTTTTCCTTCTAAGAGCCAGG - Intergenic