ID: 923554822

View in Genome Browser
Species Human (GRCh38)
Location 1:234992307-234992329
Sequence TCATACCTGCAGATTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923554822_923554824 2 Left 923554822 1:234992307-234992329 CCCTGCAGAATCTGCAGGTATGA No data
Right 923554824 1:234992332-234992354 TGTCCCCCTGCTCTATATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923554822 Original CRISPR TCATACCTGCAGATTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr