ID: 923555191

View in Genome Browser
Species Human (GRCh38)
Location 1:234994736-234994758
Sequence CTGGTTACAGACGGTTGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923555191_923555198 11 Left 923555191 1:234994736-234994758 CCGGCACAACCGTCTGTAACCAG No data
Right 923555198 1:234994770-234994792 TCCTCAGAACGAGTGGATGCCGG No data
923555191_923555197 4 Left 923555191 1:234994736-234994758 CCGGCACAACCGTCTGTAACCAG No data
Right 923555197 1:234994763-234994785 TGCTAACTCCTCAGAACGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923555191 Original CRISPR CTGGTTACAGACGGTTGTGC CGG (reversed) Intergenic
No off target data available for this crispr