ID: 923555197

View in Genome Browser
Species Human (GRCh38)
Location 1:234994763-234994785
Sequence TGCTAACTCCTCAGAACGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923555192_923555197 -5 Left 923555192 1:234994745-234994767 CCGTCTGTAACCAGCCCCTGCTA No data
Right 923555197 1:234994763-234994785 TGCTAACTCCTCAGAACGAGTGG No data
923555189_923555197 8 Left 923555189 1:234994732-234994754 CCCACCGGCACAACCGTCTGTAA No data
Right 923555197 1:234994763-234994785 TGCTAACTCCTCAGAACGAGTGG No data
923555186_923555197 21 Left 923555186 1:234994719-234994741 CCCTGAACCTTCTCCCACCGGCA No data
Right 923555197 1:234994763-234994785 TGCTAACTCCTCAGAACGAGTGG No data
923555190_923555197 7 Left 923555190 1:234994733-234994755 CCACCGGCACAACCGTCTGTAAC No data
Right 923555197 1:234994763-234994785 TGCTAACTCCTCAGAACGAGTGG No data
923555188_923555197 14 Left 923555188 1:234994726-234994748 CCTTCTCCCACCGGCACAACCGT No data
Right 923555197 1:234994763-234994785 TGCTAACTCCTCAGAACGAGTGG No data
923555191_923555197 4 Left 923555191 1:234994736-234994758 CCGGCACAACCGTCTGTAACCAG No data
Right 923555197 1:234994763-234994785 TGCTAACTCCTCAGAACGAGTGG No data
923555187_923555197 20 Left 923555187 1:234994720-234994742 CCTGAACCTTCTCCCACCGGCAC No data
Right 923555197 1:234994763-234994785 TGCTAACTCCTCAGAACGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923555197 Original CRISPR TGCTAACTCCTCAGAACGAG TGG Intergenic
No off target data available for this crispr