ID: 923558395

View in Genome Browser
Species Human (GRCh38)
Location 1:235020174-235020196
Sequence CCTTTCAAAGTGAATACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923558395_923558399 24 Left 923558395 1:235020174-235020196 CCTGCAGTATTCACTTTGAAAGG No data
Right 923558399 1:235020221-235020243 ACACCCTGCTTCTTAAAGGTAGG No data
923558395_923558398 20 Left 923558395 1:235020174-235020196 CCTGCAGTATTCACTTTGAAAGG No data
Right 923558398 1:235020217-235020239 TCACACACCCTGCTTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923558395 Original CRISPR CCTTTCAAAGTGAATACTGC AGG (reversed) Intergenic