ID: 923558399 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:235020221-235020243 |
Sequence | ACACCCTGCTTCTTAAAGGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
923558397_923558399 | -10 | Left | 923558397 | 1:235020208-235020230 | CCTGTTTTGTCACACACCCTGCT | No data | ||
Right | 923558399 | 1:235020221-235020243 | ACACCCTGCTTCTTAAAGGTAGG | No data | ||||
923558395_923558399 | 24 | Left | 923558395 | 1:235020174-235020196 | CCTGCAGTATTCACTTTGAAAGG | No data | ||
Right | 923558399 | 1:235020221-235020243 | ACACCCTGCTTCTTAAAGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
923558399 | Original CRISPR | ACACCCTGCTTCTTAAAGGT AGG | Intergenic | ||