ID: 923558399

View in Genome Browser
Species Human (GRCh38)
Location 1:235020221-235020243
Sequence ACACCCTGCTTCTTAAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923558397_923558399 -10 Left 923558397 1:235020208-235020230 CCTGTTTTGTCACACACCCTGCT No data
Right 923558399 1:235020221-235020243 ACACCCTGCTTCTTAAAGGTAGG No data
923558395_923558399 24 Left 923558395 1:235020174-235020196 CCTGCAGTATTCACTTTGAAAGG No data
Right 923558399 1:235020221-235020243 ACACCCTGCTTCTTAAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923558399 Original CRISPR ACACCCTGCTTCTTAAAGGT AGG Intergenic